Prev. | 

RIKEN DNA Bank Human Resource - CCDC50

Gene ID NCBI Gene 152137 |  KEGG hsa:152137
Gene Symbol CCDC50
Protein Name coiled-coil domain containing 50
Synonyms C3orf6|DFNA44|YMER
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056101 IRAK140E05 pCMV-SPORT6 BC065004 NM_174908 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040945 W01A102G01 pENTR-TOPO IRAK140E05 BC065004 NM_174908  
HGE040947 W01A102G03 pENTR-TOPO IRAK140E05 BC065004 NM_174908  
HGE040951 W01A102G07 pENTR-TOPO IRAK140E05 BC065004 NM_174908  
HGE040953 W01A102G09 pENTR-TOPO IRAK140E05 BC065004 NM_174908  
HGE040961 W01A102G17 pENTR-TOPO IRAK140E05 BC065004 NM_174908  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043727 ARe09F07 pKA1U5 NM_174908.2  
NGGGATTGGGGCCGGGGACGCGGAGCAGGATGGCCGCNGCGGGGCAGCTGGGCCGCCAGC
HKR161325 ARi03F05 pGCAP10 NM_174908.2  
GATCGATTGGGGCCGGGGACGCGGAGCAGGTGGCCGCGGCGGGGCAGCTGGGCCGCCAGC
HKR234810 ARiS087A10 pGCAP10 NM_174908.2  
GGCGGAGCAGGTGGCCGCGGCGGGGCAGCTGGGCCGCCAGCTTGGTGCCTCGGGGACCGT
HKR247252 ARiS118C04 pGCAP10 NM_174908.2  
GCTTCCTGTCTGTTTTTCCTCCATCTACTGTAGTATGCCGAGATTTTGCTGTCCTGGAGG
HKR367652 RBd19C04 pGCAP10 NM_174908.2  
GATCTTCGCTCGCCAGCCACTCGCAATTGCGGTTACAGACCTGCAGCTCCCCCTCCCCCA
HKR384904 RBd62E08 pGCAP10 NM_174908.2  
GACAAAGGAGACAACAGCGAGGCGGCAGCGGGCGCTGATCTTCGCTCGCCAGCCACTCGC
HKR428105 RBdS070E09 pGCAP10 NM_174908.2  
GGGTCCATTTCCGGGCTCCNGATATTTGGTATCGATTGGGGCCGGGGACGCGGAGCANGT
HKR430340 RBdS075O04 pGCAP10 NM_174908.2  
GGGACGGCCCCGGTCCATTTCCGGGCTCCGGATATTTGGTATCGATTGGGGCCGGGGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl