Prev. |  KEGG KO K18171 > 

RIKEN DNA Bank Human Resource - CMC1

Gene ID NCBI Gene 152100 |  KEGG hsa:152100
Gene Symbol CMC1
Protein Name C-X9-C motif containing 1
Synonyms C3orf68
Ortholog resources KEGG ortholog (KEGG orthology K18171) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046308 IRAK115M20 pCMV-SPORT6 BC052644 NM_182523

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095613 M01C039A13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095661 M01C039C13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095709 M01C039E13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095757 M01C039G13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095805 M01C039I13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095853 M01C039K13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095901 M01C039M13 pDONR221 MGC09-A07 BC052644 NM_182523  
HGE095949 M01C039O13 pDONR221 MGC09-A07 BC052644 NM_182523  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR124427 ARh11B03 pGCAP1 NM_182523.1  
AAGGNGGTGCTTTGCGAGGGCCCGTGTTTCTGTTGCGGGAAGCTCCCGGGGGTCGCAAAG
HKR380028 RBd50B04 pGCAP10 NM_182523.1  
GGGGCGGCGGAAGTAGGAGCCTGGGAAGGAAGAGGGAACGGGTCCTGGCGGTGCTTTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl