Prev. | 

RIKEN DNA Bank Human Resource - GLIPR2

Gene ID NCBI Gene 152007 |  KEGG hsa:152007
Gene Symbol GLIPR2
Protein Name GLI pathogenesis related 2
Synonyms C9orf19|GAPR-1|GAPR1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY094495 IRAL036D23 pDNR-LIB BC017918 NM_022343 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203228 ARiS008B04 pGCAP10 NM_022343.2  
GAGTGCAGCGCAGCCGCGGGGAGCGAGGAGCGCGCGGAGCCGGCCATGGGCAAGTCAGCT
HKR462523 RBdS156F03 pGCAP10 NM_022343.2  
GGCAGTGCAGCGCAGCCGCGGGGAGCGAGGAGCGCGCGGAGCCGGCCATGGGCAAGTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl