Prev. | 

RIKEN DNA Bank Human Resource - CCDC80

Gene ID NCBI Gene 151887 |  KEGG hsa:151887
Gene Symbol CCDC80
Protein Name coiled-coil domain containing 80
Synonyms CL2|DRO1|LINC01279|SSG1|URB|okuribin
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04591 SEREX clone NGO-Br-26 (ID 833, 834) #1 SEREX clone NGO-Br-26 (ID 833, 834) #1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069872 IRAK174L08 pCMV-SPORT6 BC073164 NM_199512 Partial/var
HGY097746 IRAL044G02 pOTB7 BC042128 NM_199512 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043680 ARe09D08 pKA1U5 NM_199512.1  
GGCCCTCTCACTCCTCACTGAGTCCACTCTGAACGTGCTAAAATGGGAAGGAGGCGGTGT
HKR045628 ARe14B04 pKA1U5 NM_199512.1  
GAGTTCATCTAGGAAACTGTCCTGGGAACCAAACTTCTGATTTCTTTTGCAACCCTCTGC
HKR046573 ARe16H05 pKA1U5 NM_199512.1  
GGCTNTCATGNNANNGAGGCGGGGTTNTGCTGCATCTGATGANANTCTNNAGNGANCGTT
HKR052851 ARe32C03 pKA1U5 NM_199512.1  
GGCCCTCTCACTCCNCACTGAAGTTCCACGTCTGNACGNGCTAAAATGGNAAGGAGGCGG
HKR057257 ARe43C09 pKA1U5 NM_199512.1  
GAGTGGCTGCTGTTGTTTGAGTTTGGTTTGGAGCAAAACTGAGGTAGTCCTAACATTTCT
HKR064079 ARe60D07 pKA1U5 NM_199512.1  
GAGCCCTCTCACTCCTCACTGAGTCCACTCTGAACGTGCTAAAATGGGAAGGAGGCGGTG
HKR070951 ARe77G07 pKA1U5 NM_199512.1  
GGCTGTTGTTTGAGTTTGGTTTGGAGCAAAACNNATGTAGTCCTAACATTTCTGGGACTG
HKR076833 ARe92B09 pKA1U5 NM_199512.1  
GAGTGGCTGCTGTTGTTTGAGTTTGGTTTGGAGCAAAACTGAGGTAGTCCTAACATTTCT
HKR082575 ARf06H07 pKA1U5 NM_199512.1  
GAGCCCTCTCACTCCTCACTGAGTCCACTCTGAACGTGCTAAAATGGGAAGGAGGCGGTG
HKR171298 ARi28E02 pGCAP10 NM_199512.1  
GGGAACCAAACTTCTGATTTCTTTTGCAACCCTCTGCATTCCATCTCTATGAGCCACCAT
HKR186036 ARi65B12 pGCAP10 NM_199512.1  
GAGCCCTCTCACTCCTCACTGAGTCCACTCTGACNTGCTNANTGGGAAGGAGGCGGTGTT
HKR208270 ARiS020L06 pGCAP10 NM_199512.1  
GAGTGGCTGCTGTTGTTTGAGTTTGGTTTGGAGCAAAACTGAGGTAGTCCTAACATTTCT
HKR234290 ARiS085M02 pGCAP10 NM_199512.1  
GGCCCTCTCACTCCTCACTGAGTCCACTCTGAACGTGCTAAAATGGGAAGGAGGCGGTGT
HKR260073 ARiS150D01 pGCAP10 NM_199512.1  
GGAGAATTTTCTCCTTCCAAAGTACAGTGTAAGAACAGACTGGAAGAGAAGTTACCCCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl