Prev. | 

RIKEN DNA Bank Human Resource - TAFA4

Gene ID NCBI Gene 151647 |  KEGG hsa:151647
Gene Symbol TAFA4
Protein Name TAFA chemokine like family member 4
Synonyms FAM19A4|TAFA-4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020308 IRAK050M20 pCMV-SPORT6 BC031566 NM_182522 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084831 M01C012B07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE084879 M01C012D07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE084927 M01C012F07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE084975 M01C012H07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE085023 M01C012J07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE085071 M01C012L07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE085119 M01C012N07 pDONR221 FLJ03-G04 AK057890 NM_182522  
HGE085167 M01C012P07 pDONR221 FLJ03-G04 AK057890 NM_182522  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406153 RBdS015G09 pGCAP10 NM_001005527.1  
GGCCGCCCTGGACGGGGCGCACCGACTGCGCGCGCGGCTGCGGGCAAACATCGGGAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl