Prev. |  KEGG KO K16940 > 

RIKEN DNA Bank Human Resource - SEPTIN10

Gene ID NCBI Gene 151011 |  KEGG hsa:151011
Gene Symbol SEPTIN10
Protein Name septin 10
Synonyms SEPT10
Ortholog resource in our bank

  SEPTIN10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009062 IRAK022K22 pCMV-SPORT6 BC020502 NM_144710 Full
HGY036238 IRAK090J22 pBluescript BC050345 NM_178584 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260222 ARiS150J06 pGCAP10 NM_144710.2  
GCCCTCCGGCCTTCCCGCCGCCGTCNCCGGGACCAGCCGCTCGGGGCCGGGCTGATACAG
HKR452952 RBdS132G08 pGCAP10 NM_144710.2  
GCCCTTCCCCGNCGCGNANGCAGCCTAGCCTCGCGCCCCGCCCGTTGCTTCTGCCCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl