Prev. | 

RIKEN DNA Bank Human Resource - ITPRIPL1

Gene ID NCBI Gene 150771 |  KEGG hsa:150771
Gene Symbol ITPRIPL1
Protein Name ITPRIP like 1
Synonyms KIAA1754L
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013434 IRAK033J18 pBluescriptR BC034503 NM_178495 Full/var
HGX069728 IRAK174F08 pCMV-SPORT6 BC073153 NM_001008949 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089232 M01C023B08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089280 M01C023D08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089328 M01C023F08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089376 M01C023H08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089424 M01C023J08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089472 M01C023L08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089520 M01C023N08 pDONR221 MGC01-D04 BC034503 NM_178495  
HGE089568 M01C023P08 pDONR221 MGC01-D04 BC034503 NM_178495  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR382949 RBd57G05 pGCAP10 NM_001008949.1  
AGGGCGGGGAGACGAAGCAAGGCCAAGTTCCAAAGGGAGGATAGGCCCAGCTGGCTTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl