Prev. |  KEGG KO K22557 > 

RIKEN DNA Bank Human Resource - COMMD1

Gene ID NCBI Gene 150684 |  KEGG hsa:150684
Gene Symbol COMMD1
Protein Name copper metabolism domain containing 1
Synonyms C2orf5|MURR1
Ortholog resources KEGG ortholog (KEGG orthology K22557) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY090170 IRAL025H02 pOTB7 BC009266 NM_152516 Partial
HGY095206 IRAL038A06 pDNR-LIB BC022046 NM_152516 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR016148 ARa40G04 pKA1U5 NM_152516.2  
GGCGGCGGGCGAGCTTGAGGGTGGCAAACCCCTGAGCGGGCTGCTGAATGCGCTGGCCCA
HKR420636 RBdS051J20 pGCAP10 NM_152516.2  
GAGAGCATGGCGGCGGGCGAGCTTGAGGGTGGCAAACCCCTGAGCGGGCTGCTGAATGCG
HKR420689 RBdS051M01 pGCAP10 NM_152516.2  
GAGAGCATGGCGGCGGGCGAGCTTGAGGGTGGCAAACCCCTGAGCGGGCTGCTGAATGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl