Prev. | 

RIKEN DNA Bank Human Resource - COPS9

Gene ID NCBI Gene 150678 |  KEGG hsa:150678
Gene Symbol COPS9
Protein Name COP9 signalosome subunit 9
Synonyms CSNAP|MYEOV2
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042504 ARe06E08 pKA1U5 NM_138336.1  
GCTAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGC
HKR071773 ARe79H05 pKA1U5 NM_138336.1  
GAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCG
HKR167255 ARi18C07 pGCAP10 NM_138336.1  
GGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTAC
HKR179656 ARi49C08 pGCAP10 NM_138336.1  
GGCGGCCCCGAGATGAACCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTAC
HKR188029 ARi70B05 pGCAP10 NM_138336.1  
GAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCG
HKR219629 ARiS049B05 pGCAP10 NM_138336.1  
GCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGG
HKR327233 RBb18B09 pKA1U5 NM_138336.1  
GGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGGACCTGGACGAGGTGG
HKR339352 RBb48G08 pGCAP1 NM_138336.1  
GCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGGA
HKR343635 RBb59B11 pGCAP1 NM_138336.1  
AGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGG
HKR344532 RBb61F12 pGCAP1 NM_138336.1  
TTTTTGCTAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAG
HKR393331 RBd83F11 pGCAP10 NM_138336.1  
GCTAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGC
HKR432454 RBdS081C06 pGCAP10 NM_138336.1  
GCTAGAGCGCCGCGGCCCCGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGC
HKR462468 RBdS156C20 pGCAP10 NM_138336.1  
GGAGATGAAGCCGGCGGTGGACGAGATGTTCCCCGAGGGCGCCGGGCCCTACGTGGACCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl