Prev. | 

RIKEN DNA Bank Human Resource - CDPF1

Gene ID NCBI Gene 150383 |  KEGG hsa:150383
Gene Symbol CDPF1
Protein Name cysteine rich DPF motif domain containing 1
Synonyms C22orf40
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036069 IRAK090C21 pBluescript BC045796 NM_001008917 Partial
HGY067450 IRAK168K10 pBluescriptR BC067871 NM_207327 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE108832 M01C072B08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE108880 M01C072D08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE108928 M01C072F08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE108976 M01C072H08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE109024 M01C072J08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE109072 M01C072L08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE109120 M01C072N08 pDONR221 06_10-H04 AK127072 NM_207327  
HGE109168 M01C072P08 pDONR221 06_10-H04 AK127072 NM_207327  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184130 ARi60F10 pGCAP10 NM_207327.4  
GCCTTGGACGCGGAGCCGTGGGACGAGGGCGGCGATGGCGTCCCATGTAGAGTGCCGTCC
HKR433358 RBdS083G14 pGCAP10 NM_207327.4  
GGGCGGTGAGTTCGAGGTGGCAGAGTGACTGGGGCGAGCGTGCTGTGGCCCTTCCCTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl