Prev. |  KEGG KO K04082 > 

RIKEN DNA Bank Human Resource - HSCB

Gene ID NCBI Gene 150274 |  KEGG hsa:150274
Gene Symbol HSCB
Protein Name HscB mitochondrial iron-sulfur cluster cochaperone
Synonyms DNAJC20|HSC20|JAC1
Ortholog resource in our bank

  HSCB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056368 IRAK140P08 pCMV-SPORT6 BC065569 NM_172002 Full
HGY082873 IRAL007D01 pOTB7 BC000004 NM_172002.5

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097237 M01C043B13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097285 M01C043D13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097333 M01C043F13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097381 M01C043H13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097429 M01C043J13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097477 M01C043L13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097525 M01C043N13 pDONR221 MGC11-C07 BC000004 NM_172002  
HGE097573 M01C043P13 pDONR221 MGC11-C07 BC000004 NM_172002  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR021227 ARa53B03 pKA1U5 NM_172002.3  
AGATAGGCCGCCGGCCAGATGTGGCGGGGGAGAGCCGGGGCTTTGCTCCGGGTGTGGGGG
HKR403062 RBdS007K22 pGCAP10 NM_172002.3  
CGGCCGGCCGATGGTACTTGAGGGGCAGGGCCTGGGAGACTGGAAGACTTGAATGAATAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl