Prev. | 

RIKEN DNA Bank Human Resource - COMMD7

Gene ID NCBI Gene 149951 |  KEGG hsa:149951
Gene Symbol COMMD7
Protein Name COMM domain containing 7
Synonyms C20orf92|dJ1085F17.3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036520 IRAK091E24 pBluescript BC047440 NM_053041
HGY082029 IRAL005B05 pOTB7 BC000628 NM_053041 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161203 ARi03A03 pGCAP10 NM_053041.2  
GAGCGGAGGAGGAAGCTGAGCAGGGCGGCGGCGGCGGTGGAACCTGCGGGGCTGGGGCGC
HKR171602 ARi29A02 pGCAP10 NM_053041.2  
CGGCCGGCCGATGCCCCTCCCCGGAGCCCGGCGGCCGCGCGTGTCCGCGGCCCTGCGAGG
HKR260140 ARiS150F20 pGCAP10 NM_053041.2  
GAGCGGAGGAGGAAGCTGAGCAGGGCGGCGGCGGCGGTGGAACCTGCGGGGCTGGGGCGC
HKR428088 RBdS070D16 pGCAP10 NM_053041.2  
GGGCAGCGGAGGAGGAAGCTGAGCAGGGCGGCGGCGGCGGTGGAACCTGCGGGGCTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl