Prev. |  KEGG KO K15709 > 

RIKEN DNA Bank Human Resource - RNF187

Gene ID NCBI Gene 149603 |  KEGG hsa:149603
Gene Symbol RNF187
Protein Name ring finger protein 187
Synonyms RACO-1|RACO1
Ortholog resource in our bank

  RNF187

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001629 IRAK004B05 pCMV-SPORT6 BC000821 XM_938760 Partial/var
HGX046006 IRAK115A06 pCMV-SPORT6 BC053571 XM_938760 Partial/var
HGY089454 IRAL023K14 pOTB7 BC008022 XM_938760 Partial/var
HGY089683 IRAL024D11 pOTB7 BC012758 XM_938760 Partial
HGY100157 IRAL050G13 pOTB7 BC064481 XM_938760 Partial
HGY103743 IRAL059F23 pOTB7 BC080645 XM_938760 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332860 RBb32C12 pGCAP1 NM_001010858.1  
GCGTCCCCGGCGTTGGCGTCTTCGTCCTGATTGCTGGTCTCCGNTTCGGTTCGCCGGCCG
HKR382029 RBd55B05 pGCAP10 NM_001010858.1  
TCGTCCTGTTGCTGGTCTCCGTCCGGTCGCCGGCCGTCTANNNNNNNNGCCCTCCCCAGC
HKR397284 RBd93D12 pGCAP10 NM_001010858.1  
GGCCCCGTGCGCGTCCCCGGCGTTGGCGTCTTCGTCCTGTTGCTGGTCTCCGTCCGGTCG
HKR398107 RBd95E11 pGCAP10 NM_001010858.1  
GGCCCCGTGCGCGTCCCCGGCGTTGGCGTCTTCGTCCTGTTGCTGGTCTCCGTCCGGTCG
HKR444069 RBdS110C21 pGCAP10 NM_001010858.1  
GGCGCTGCAGCTGCTGTGCCGCGCCGACGCCGGCCCGCTCTGCGCCGCCTGCCGTATGGC
HKR444225 RBdS110J09 pGCAP10 NM_001010858.1  
TCGTCCTGTTGCTGGTCTCCGTCCGGTCGCCGGCCGTCTAGGTCTCCGGCCCTCCCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl