Prev. | 

RIKEN DNA Bank Human Resource - SHISA4

Gene ID NCBI Gene 149345 |  KEGG hsa:149345
Gene Symbol SHISA4
Protein Name shisa family member 4
Synonyms C1orf40|TMEM58
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005877 IRAK014L13 pCMV-SPORT6 BC009558 NM_198149 Full/var
HGX053771 IRAK134H03 pCMV-SPORT6 BC061908 NM_198149 Partial/var
HGY066852 IRAK167C04 pBluescriptR BC066977 NM_198149 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042856 ARe07C08 pKA1U5 NM_198149.1  
GTGGGCCCCGCCGCAGCTCCAGCTGGCCGGCTTGGTCCATGCGGTCCCTTCTCTGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl