Prev. | 

RIKEN DNA Bank Human Resource - MANEAL

Gene ID NCBI Gene 149175 |  KEGG hsa:149175
Gene Symbol MANEAL
Protein Name mannosidase endo-alpha like
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016914 IRAK042E18 pCMV-SPORT6 BC031903 NM_152496 Partial
HGX034824 IRAK087A24 pCMV-SPORT6 BC038190 NM_152496 Partial/var
HGX053804 IRAK134I12 pCMV-SPORT6 BC063587 NM_152496 Full/var
HGY088180 IRAL020H12 pOTB7 BC009952 NM_152496 Partial
HGY101829 IRAL054J13 pOTB7 BC077730 NM_152496

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329776 RBb24H08 pGCAP1 NM_001031740.2  
CGGCTGCCTGGGAAGCGCGCGGCCGGGCGGGCGGCCATGGCGCGGCACGCTGGGAGGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl