Prev. | 

RIKEN DNA Bank Human Resource - SAMD11

Gene ID NCBI Gene 148398 |  KEGG hsa:148398
Gene Symbol SAMD11
Protein Name sterile alpha motif domain containing 11
Synonyms MRS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096812 IRAL042A12 pOTB7 BC024295 NM_152486 Partial/var
HGY097409 IRAL043I17 pOTB7 BC033213 NM_152486 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100844 M01C052B20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE100892 M01C052D20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE100940 M01C052F20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE100988 M01C052H20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE101036 M01C052J20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE101084 M01C052L20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE101132 M01C052N20 pDONR221 MGC15-H10 BC033213 ENST00000342066  
HGE101180 M01C052P20 pDONR221 MGC15-H10 BC033213 ENST00000342066  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329234 RBb23B10 pGCAP1 NM_152486.2  
TGCCTTTACGGGAACGGGGGCGGGGGGGACGCCGCTCATTGCGCTGCCGTCCACAGGGAG
HKR330570 RBb26H02 pGCAP1 NM_152486.2  
GGGTCCGGCAGGAGGTGGCGGCTGCAGCTCTGAGGGGCCCCAGTGGCCTGGAAGCCCACC
HKR373612 RBd34A12 pGCAP10 NM_152486.2  
TGCTCTGCGGGCTGGCACCCGGCCCGGGGCGGGACCCACCTCCGCTTTCGGGGAGCTGCC
HKR374807 RBd37A07 pGCAP10 NM_152486.2  
AGCTAGCGCGGGGGCGCTGGGCCCCGCTGGGAGCGGTGCGGGCGGCCGCGCCGGCTGGGC
HKR386882 RBd67D10 pGCAP10 NM_152486.2  
GGGGGTGTATTTCGTCCACGAGCCGGGGAGGGGGTACTGGCCCTGCCGCTGACTGCGCGC
HKR394971 RBd87H03 pGCAP10 NM_152486.2  
GGGCGGCGGAGTCTCCCAAGTCCCCGCCGGGCGGGCGCGCGCCAGTGGACGCGGGTGCAC
HKR461980 RBdS154P20 pGCAP10 NM_152486.2  
GACTGCGCAGGACTGCTCCGTTACAGCCAGGACGGCAACCTTCCCACCCTCATATCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl