Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF555

Gene ID NCBI Gene 148254 |  KEGG hsa:148254
Gene Symbol ZNF555
Protein Name zinc finger protein 555
Synonyms -
Ortholog resource in our bank

  ZNF555

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013270 IRAK033C22 pBluescriptR BC022022 NM_152791

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042547 W01A106G03 pENTR-TOPO IRAK033C22 BC022022 NM_152791  
HGE042549 W01A106G05 pENTR-TOPO IRAK033C22 BC022022 NM_152791  
HGE042551 W01A106G07 pENTR-TOPO IRAK033C22 BC022022 NM_152791  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042429 ARe06B05 pKA1U5 NM_152791.3  
GGTCCTAGCCGCTGAGTGCCCCGCCTGCCCCTAGCGGTCCCTGGCGTCCCGGTTCCTGNT
HKR182956 ARi57G12 pGCAP10 NM_152791.3  
TAGCTTTTTCAGCTGCGCCGGCCGCGAGGCCACGGAGAGCTCGCCTTGGAGAGCCCAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl