Prev. |  KEGG KO K09228 > 

RIKEN DNA Bank Human Resource - ZNF599

Gene ID NCBI Gene 148103 |  KEGG hsa:148103
Gene Symbol ZNF599
Protein Name zinc finger protein 599
Synonyms -
Ortholog resource in our bank

  ZNF599

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016912 IRAK042E16 pCMV-SPORT6 BC033354 NM_001007248 Partial
HGY042631 IRAK106J15 pBluescript BC044615 NM_001007248

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE027962 W01A069P02 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  
HGE027964 W01A069P04 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  
HGE027966 W01A069P06 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  
HGE027968 W01A069P08 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  
HGE027970 W01A069P10 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  
HGE027972 W01A069P12 pENTR-TOPO IRAK106J15 BC044615 NM_001007248  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044411 ARe11A11 pKA1U5 NM_001007248.2  
GAGTCTTCGTCCGCCGTTAGGTTGCGGCTGCTGTGGTTGCCAACGCTACACTGGGTAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl