Prev. |  KEGG KO K11549 > 

RIKEN DNA Bank Human Resource - SPC24

Gene ID NCBI Gene 147841 |  KEGG hsa:147841
Gene Symbol SPC24
Protein Name SPC24 component of NDC80 kinetochore complex
Synonyms SPBC24
Ortholog resource in our bank

  SPC24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR390426 RBd76B02 pGCAP10 NM_182513.2  
GAGTCANGNCCGCCTTCCGCGACATAGAGGAGGTGAGCCAGGGGCTGCTCAGCCTGCTGG
HKR420510 RBdS051E14 pGCAP10 NM_182513.2  
GGCGCGGGTTGGAGCCTGGCGTAGTCATGGCCGCCTTCCGCGACATAGAGGAGGTGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl