Prev. | 

RIKEN DNA Bank Human Resource - LINC00526

Gene ID NCBI Gene 147525 |  KEGG hsa:147525
Gene Symbol LINC00526
Protein Name long intergenic non-protein coding RNA 526
Synonyms C18orf18|HsT959
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007681 IRAK019D09 pCMV-SPORT6 BC010538 XM_939077 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092033 M01C030B09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092081 M01C030D09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092129 M01C030F09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092177 M01C030H09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092225 M01C030J09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092273 M01C030L09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092321 M01C030N09 pDONR221 MGC04-G05 BC010538 XM_928362  
HGE092369 M01C030P09 pDONR221 MGC04-G05 BC010538 XM_928362  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331308 RBb28E12 pGCAP1 NR_026849.1  
GGTGTCGGCGCGGGGGCGGATCCCGGTGGCGGCGAGGGGCGGACTCCGCGGACAAGGCCA
HKR375375 RBd38H07 pGCAP10 NR_026849.1  
GGGCGGCGAGGGGCGGACTCCGCGGACAAGGCCAGGCCTAGCCTTGAGCTCCGTCGGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl