Prev. | 

RIKEN DNA Bank Human Resource - TMEM199

Gene ID NCBI Gene 147007 |  KEGG hsa:147007
Gene Symbol TMEM199
Protein Name transmembrane protein 199
Synonyms C17orf32|CDG2P|VMA12|VPH2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097470 IRAL043L06 pOTB7 BC033113 NM_152464

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100832 M01C052B08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE100880 M01C052D08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE100928 M01C052F08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE100976 M01C052H08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE101024 M01C052J08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE101072 M01C052L08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE101120 M01C052N08 pDONR221 MGC15-H04 BC033113 NM_152464  
HGE101168 M01C052P08 pDONR221 MGC15-H04 BC033113 NM_152464  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR361207 RBd03A07 pGCAP10 NM_152464.1  
GAGATATGGCGTCCTCTTTGCTTGCGGGCGAGCGATTGGTGCGTGCTTTGGGCCCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl