Prev. |  KEGG KO K10282 > 

RIKEN DNA Bank Human Resource - FBXL16

Gene ID NCBI Gene 146330 |  KEGG hsa:146330
Gene Symbol FBXL16
Protein Name F-box and leucine rich repeat protein 16
Synonyms C16orf22|Fbl16|c380A1.1
Ortholog resource in our bank

  FBXL16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018955 IRAK047G11 pBluescriptR BC036680 NM_153350

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018606 W01A046I14 pENTR-TOPO IRAK047G11 BC036680 NM_153350  
HGE018608 W01A046I16 pENTR-TOPO IRAK047G11 BC036680 NM_153350  
HGE018610 W01A046I18 pENTR-TOPO IRAK047G11 BC036680 NM_153350  
HGE018614 W01A046I22 pENTR-TOPO IRAK047G11 BC036680 NM_153350  
HGE018616 W01A046I24 pENTR-TOPO IRAK047G11 BC036680 NM_153350  
HGE018642 W01A046K02 pENTR-TOPO IRAK047G11 BC036680 NM_153350  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372147 RBd30G03 pGCAP10 NM_153350.2  
GGCGCGCGGCGCCGGCGGCGGCCACGGAGGAGCGCGGGGAGGGCGAGGGGAGGAGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl