Prev. | 

RIKEN DNA Bank Human Resource - C15orf61

Gene ID NCBI Gene 145853 |  KEGG hsa:145853
Gene Symbol C15orf61
Protein Name chromosome 15 open reading frame 61
Synonyms -
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR331258 RBb28C10 pGCAP1 NM_001143936.1  
GGCGGCGGGCCATGGAGGCCCTGAGGAGGGCCCACGAGGTCGCGCTCCGCCTGCTGCTGT
HKR333676 RBb34D04 pGCAP1 NM_001143936.1  
HKR395347 RBd88G03 pGCAP10 NM_001143936.1  
GACCAGCCTGCGTCCCCGGCGCGGCGGGCCATGGAGGCCCTGAGGAGGGCCCACGAGGTC
HKR442302 RBdS105M14 pGCAP10 NM_001143936.1  
GGCGGCGGGCCATGGAGGCCCTGAGGAGGGCCCACGAGGTCGCGCTCCGCCTGCTGCTGT
HKR442367 RBdS105P07 pGCAP10 NM_001143936.1  
GGCGGCGGGCCATGGAGGCCCTGAGGAGGGCCCACGAGGTCGCGCTCCGCCTGCTGCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl