Prev. | 

RIKEN DNA Bank Human Resource - LYSMD4

Gene ID NCBI Gene 145748 |  KEGG hsa:145748
Gene Symbol LYSMD4
Protein Name LysM domain containing 4
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031403 IRAK078I11 pCMV-SPORT6 BC041097 NM_152449 Full/var
HGY103696 IRAL059D24 pOTB7 BC084545 NM_152449 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094034 M01C035B10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094082 M01C035D10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094130 M01C035F10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094178 M01C035H10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094226 M01C035J10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094274 M01C035L10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094322 M01C035N10 pDONR221 MGC07-D05 BC041097 ENST00000344791  
HGE094370 M01C035P10 pDONR221 MGC07-D05 BC041097 ENST00000344791  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260354 ARiS150O18 pGCAP10 NM_152449.2  
GGCGAGTCGCCGGTCGCCGGTCGCGGCGGAGCCTGGGCGCTGAGTGAAGAAAATGAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl