RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - MDP1

Gene ID	NCBI Gene 145553 \| KEGG hsa:145553
Gene Symbol	MDP1
Protein Name	magnesium dependent phosphatase 1
Synonyms	FN6PASE\|MDP-1

Ortholog resource in our bank

  MDP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY042717	IRAK106N05	pBluescript	BC046912	NM_138476	Full/var
HGY090142	IRAL025F22	pOTB7	BC009495	NM_138476	Partial/var
HGY098972	IRAL047H04	pOTB7	BC051382	NM_138476

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR346483	RBb66D11	pGCAP1	NM_138476.2
HKR346483	GGCCTGCGGTGCGGGTCATGGCGCGGCTACCGAAGCTGGCAGTCTTTGATTTGGATTACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl