Prev. | 

RIKEN DNA Bank Human Resource - PHETA1

Gene ID NCBI Gene 144717 |  KEGG hsa:144717
Gene Symbol PHETA1
Protein Name PH domain containing endocytic trafficking adaptor 1
Synonyms FAM109A|IPIP27A|SES1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020906 IRAK052E10 pCMV-SPORT6 BC034809 NM_144671

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093244 M01C033B20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093292 M01C033D20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093340 M01C033F20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093388 M01C033H20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093436 M01C033J20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093484 M01C033L20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093532 M01C033N20 pDONR221 MGC06-D10 BC034809 NM_144671  
HGE093580 M01C033P20 pDONR221 MGC06-D10 BC034809 NM_144671  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387751 RBd69G07 pGCAP10 NM_144671.3  
GGCGCTCTCCCGCGGCTGCGCCGGCCCGGCCGCCCAGGAGACAAAGCGCTGCCGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl