Prev. | 

RIKEN DNA Bank Human Resource - ZNF664

Gene ID NCBI Gene 144348 |  KEGG hsa:144348
Gene Symbol ZNF664
Protein Name zinc finger protein 664
Synonyms ZFOC1|ZNF176
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028025 IRAK070B01 pBluescriptR BC037793 NM_152437 Partial/var
HGY036539 IRAK091F19 pBluescript BC051696 NM_152437 Full/var
HGY094530 IRAL036F10 pDNR-LIB BC017960 NM_152437 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021419 W01A053J03 pENTR-TOPO flj0002i12 AK056034 NM_152437  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179373 ARi48H05 pGCAP10 NM_152437.1  
CGGCCGGCCGATGGAGGTGTCCCTGAGGAGAGGGAGGGCGCCCTGCGTCCGACAGAGGAG
HKR187281 ARi68D09 pGCAP10 NM_152437.1  
GGGAGGCGTCTGGGTGTGCGGAGCGCGCGCGCGCGCGGCTCGGAGGCGCACCTGTGAGGT
HKR364126 RBd10F06 pGCAP10 NM_152437.1  
GGGAGAGGGAGGTGGGTGCGCGGCGCCCGCGGCCTGGGGCGCTGACTCCCCTCACTTGGA
HKR462619 RBdS156J03 pGCAP10 NM_152437.1  
GGTGCGGAGCGCGCGCGCGCGCGGCTCGGAGGCGCACCTGTGAGGTGTCCCTGAGGAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl