Prev. | 

RIKEN DNA Bank Human Resource - SPINDOC

Gene ID NCBI Gene 144097 |  KEGG hsa:144097
Gene Symbol SPINDOC
Protein Name spindlin interactor and repressor of chromatin binding
Synonyms C11orf84|SPIN-DOC
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035812 IRAK089I20 pCMV-SPORT6 BC056402 NM_138471
HGY084943 IRAL012F23 pOTB7 BC002782 NM_138471 Full
HGY089553 IRAL023O17 pOTB7 BC007540 NM_138471 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094843 M01C037B19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE094891 M01C037D19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE094939 M01C037F19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE094987 M01C037H19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE095035 M01C037J19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE095083 M01C037L19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE095131 M01C037N19 pDONR221 MGC08-C10 BC056402 ENST00000294244  
HGE095179 M01C037P19 pDONR221 MGC08-C10 BC056402 ENST00000294244  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364432 RBd11B08 pGCAP10 NM_138471.1  
GCCCGGATTGAGCCCTCCCCGCCCGGGCTCCCGACGCGCCGAGGTCTCGGGGAGGCCCGG
HKR378571 RBd46H03 pGCAP10 NM_138471.1  
GCCGGATTGAGCCCTCCCCGCCCGGGCTCCCGACGCGCCGAGGTCTCGGGGAGGCCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl