Prev. | 

RIKEN DNA Bank Human Resource - POGLUT3

Gene ID NCBI Gene 143888 |  KEGG hsa:143888
Gene Symbol POGLUT3
Protein Name protein O-glucosyltransferase 3
Synonyms KDELC2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019054 IRAK047K14 pBluescriptR BC036526 NM_153705 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099633 M01C049B09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099681 M01C049D09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099729 M01C049F09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099777 M01C049H09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099825 M01C049J09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099873 M01C049L09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099921 M01C049N09 pDONR221 MGC14-C05 BC036526 ENST00000323468  
HGE099969 M01C049P09 pDONR221 MGC14-C05 BC036526 ENST00000323468  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218271 ARiS045L07 pGCAP10 NM_153705.4  
GAGTTGTGCCCCGCCGACCATGCNCCGCCTCCCGCGGGCCCTGCTGCTGCAGCTGCGCCT
HKR219665 ARiS049C17 pGCAP10 NM_153705.4  
GCCTCCTCGCCGCCGCGGAGCTGGACCGCAGTTGTGCCCCGCCGACCATGCGCCGCCTCC
HKR403157 RBdS007O21 pGCAP10 NM_153705.4  
GGGTCCGCGGCGCTGCCGGCCCCTCCTCGCCGCCGCGGAGCTGGACCGCAGTTGTGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl