Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CACUL1

Gene ID (NCBI) 143384
Gene Symbol CACUL1
Protein Name CDK2-associated, cullin domain 1
Synonyms C10orf46|CAC1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY018873 IRAK047D01 pBluescriptR BC038294 NM_153810 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089644 M01C024B20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089692 M01C024D20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089740 M01C024F20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089788 M01C024H20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089836 M01C024J20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089884 M01C024L20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089932 M01C024N20 pDONR221 MGC01-H10 BC038294 ENST00000340214  
HGE089980 M01C024P20 pDONR221 MGC01-H10 BC038294 ENST00000340214  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392528 RBd81F08 pGCAP10 NM_153810.4  
GGTCAGCCGCGTCTTCAAGCTAGTCGGCCCCGCGGAGAGCGAGAGACCCTGCGCACCGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl