Prev. |  KEGG KO K12260 > 

RIKEN DNA Bank Human Resource - SRXN1

Gene ID NCBI Gene 140809 |  KEGG hsa:140809
Gene Symbol SRXN1
Protein Name sulfiredoxin 1
Synonyms C20orf139|Npn3|SRX|SRX1
Ortholog resource in our bank

  SRXN1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011069 IRAK027L05 pCMV-SPORT6 BC017001 NM_080725 Partial
HGX027852 IRAK069K12 pCMV-SPORT6 BC032604 NM_080725 Full
HGX039263 IRAK098C15 pCMV-SPORT6 BC047707 NM_080725 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR344027 RBb60B03 pGCAP1 NM_080725.1  
GTTTTTTTCCACTCCCCGGACGCCGCGCGGCGCAGGGGAGGCGAGAGGCGCCCCCCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl