Prev. | 

RIKEN DNA Bank Human Resource - SELENOM

Gene ID NCBI Gene 140606 |  KEGG hsa:140606
Gene Symbol SELENOM
Protein Name selenoprotein M
Synonyms SELM|SEPM
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005675 IRAK014D03 pCMV-SPORT6 BC013421 NM_080430 Full/var
HGX024807 IRAK062A07 pCMV-SPORT6 BC030236 NM_080430 Full/var
HGX033839 IRAK084J23 pCMV-SPORT6 BC042299 NM_080430 Partial/var
HGX046161 IRAK115G17 pCMV-SPORT6 BC053846 NM_080430 Full/var
HGX056120 IRAK140E24 pCMV-SPORT6 BC068004 NM_080430 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092015 M01C030A15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092063 M01C030C15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092111 M01C030E15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092159 M01C030G15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092207 M01C030I15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092255 M01C030K15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092303 M01C030M15 pDONR221 MGC04-E08 BC013421 NM_080430  
HGE092351 M01C030O15 pDONR221 MGC04-E08 BC013421 NM_080430  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040881 ARe02D09 pKA1U5 NM_080430.2  
GGCCAGCCTGGAGGCCCAGACGTGGCGCAGCGACTCGGAGGTTCGCCTCCAGCTTGCGCA
HKR048148 ARe20G04 pKA1U5 NM_080430.2  
GGCATCATCTGCGGCCGGGTCCCGATGAGCCTCCTGTTGCCTCCGCTGGCGCTGCTGCTG
HKR082503 ARf06E07 pKA1U5 NM_080430.2  
GGCCTCCAGCTTGCGCATCATCTGCGGCCGGGTCCCGATGAGCCTCCTGTTGCCTCCGCT
HKR174155 ARi35G11 pGCAP10 NM_080430.2  
GATCTGCGGCCGGGTCCCGATGAGCCTCCTGTTGCCTCCGCTGGCGCTGCTGCTGCTTCT
HKR176499 ARi41E03 pGCAP10 NM_080430.2  
GTGGAGGCCCAGACGTGGCGCAGCGACTCGGAGGTTCGCCTCCAGCTTGCGCATCATCTG
HKR219855 ARiS049K15 pGCAP10 NM_080430.2  
GATCTGCGGCCGGGTCCCGATGAGCCTCCTGTTGCCTCCGCTGGCGCTGCTGCTGCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl