Prev. | 

RIKEN DNA Bank Human Resource - S100A16

Gene ID NCBI Gene 140576 |  KEGG hsa:140576
Gene Symbol S100A16
Protein Name S100 calcium binding protein A16
Synonyms AAG13|DT1P1A7|S100F
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007875 IRAK019L11 pCMV-SPORT6 BC010541 NM_080388
HGY095886 IRAL039L22 pOTB7 BC019099 NM_080388 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072036 ARe80B12 pKA1U5 NM_080388.1  
GAGCCCTGCTGGAGAGGAGGCAGACTGAGGCAGCAGGCCCCGCCAGCAGGCGAAGCAGGG
HKR166832 ARi17B08 pGCAP10 NM_080388.1  
GGCTGAGCGCAGGGAGCTGCTTGGCAGTGCCAGAGCCCAGGCCCCAGAGCCCTGCTGGAG
HKR218095 ARiS045D23 pGCAP10 NM_080388.1  
GAGTCTGCTGCTGTGTCCAGAGTCCGACTCCAGCTGGGCTGTAACTGGGCTTGGCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl