Prev. | 

RIKEN DNA Bank Human Resource - DIPK1B

Gene ID NCBI Gene 138311 |  KEGG hsa:138311
Gene Symbol DIPK1B
Protein Name divergent protein kinase domain 1B
Synonyms C9orf136|FAM69B|pp6977
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091217 IRAL028A17 pOTB7 BC032097 NM_152421

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE081245 M01C003B21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081293 M01C003D21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081341 M01C003F21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081389 M01C003H21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081437 M01C003J21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081485 M01C003L21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081533 M01C003N21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE081581 M01C003P21 pDONR221 04-134-2_2-C11 BC032097 ENST00000371692  
HGE099244 M01C048B20 pDONR221 MGC13-H10 BC032097 ENST00000371692  
HGE099292 M01C048D20 pDONR221 MGC13-H10 BC032097 ENST00000371692  
HGE099340 M01C048F20 pDONR221 MGC13-H10 BC032097 ENST00000371692  
HGE099388 M01C048H20 pDONR221 MGC13-H10 BC032097 ENST00000371692  
HGE099436 M01C048J20 pDONR221 MGC13-H10 BC032097 ENST00000371692  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR177255 ARi43C07 pGCAP10 NM_152421.3  
GAACGCGGGCCCGGGGGCGCGCGGCCCGCATGGCGAGGGAGCGGCGGCCGCTGCGGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl