Prev. |  KEGG KO K13506 > 

RIKEN DNA Bank Human Resource - GPAT4

Gene ID NCBI Gene 137964 |  KEGG hsa:137964
Gene Symbol GPAT4
Protein Name glycerol-3-phosphate acyltransferase 4
Synonyms 1-AGPAT 6|AGPAT6|LPAAT-zeta|LPAATZ|TSARG7
Ortholog resources KEGG ortholog (KEGG orthology K13506) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY099179 IRAL047P19 pOTB7 BC051377 NM_178819 Full
HGY100343 IRAL050O07 pOTB7 BC061884 NM_178819 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064852 ARe62C04 pKA1U5 NM_178819.2  
GGCAGCTTGGGCCCGCGGCGGCGGCAAGGGCGGGAGGGAGCGGTCGCCGCGGGATTTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl