Prev. | 

RIKEN DNA Bank Human Resource - CIBAR1

Gene ID NCBI Gene 137392 |  KEGG hsa:137392
Gene Symbol CIBAR1
Protein Name CBY1 interacting BAR domain containing 1
Synonyms FAM92A|FAM92A1|PAPA9
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013547 IRAK033O11 pBluescriptR BC014598 XM_943019 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068577 ARe71H09 pKA1U5 NM_145269.3  
ATCCTGGGCTGCTTGCGCCCCAGCGCGCGCCCNGGNGCCTTGGAATCCCCGTCCTTGGGC
HKR336455 RBb41C07 pGCAP1 NM_145269.3  
GGCCTTGGAATCCCCGTCCTTGGGCCCCCGCAAGGTCCCCGGCCGTGCGCGAGGCAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl