Prev. | 

RIKEN DNA Bank Human Resource - TMEM139

Gene ID NCBI Gene 135932 |  KEGG hsa:135932
Gene Symbol TMEM139
Protein Name transmembrane protein 139
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031304 IRAK078E08 pCMV-SPORT6 BC035888 NM_153345 Partial
HGY093134 IRAL032N22 pDNR-LIB BC016719 NM_153345 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE084422 M01C011A22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084470 M01C011C22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084518 M01C011E22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084566 M01C011G22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084614 M01C011I22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084662 M01C011K22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084710 M01C011M22 pDONR221 FLJ03-B11 AK075067 NM_153345  
HGE084758 M01C011O22 pDONR221 FLJ03-B11 AK075067 NM_153345  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR188526 ARi71F06 pGCAP10 NM_153345.1  
TCTACAGTCTGTGGAGACAGTTGTGTCCCTGTGGCTTTGGTGCGCCTGTGTGCACTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl