Prev. | 

RIKEN DNA Bank Human Resource - IRAK1BP1

Gene ID NCBI Gene 134728 |  KEGG hsa:134728
Gene Symbol IRAK1BP1
Protein Name interleukin 1 receptor associated kinase 1 binding protein 1
Synonyms AIP70|SIMPL
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064154 ARe60G10 pKA1U5 NM_001010844.1  
GGAGTCGTGACCGGTTGGGCCACACTCAACGTGGGACGAAGCTTCGCCTACTGTTTGACT
HKR428024 RBdS070A24 pGCAP10 NM_001010844.1  
GACTCCGGGACGCCAGGACCTGGCAGAGTGAATATTTGACCCATTCTTCTCCTAGACGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl