RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - SHROOM1

Gene ID	NCBI Gene 134549 \| KEGG hsa:134549
Gene Symbol	SHROOM1
Protein Name	shroom family member 1
Synonyms	APXL2

Ortholog resource in our bank

  SHROOM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR063278	ARe58D06	pKA1U5	NM_133456.1
HKR063278	GGAGCGCGTCTCGGCGGGAGCCTCAGGACCCACGCAGCCACCCAGCCTCAGCACTCATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl