Prev. |  KEGG KO K17618 > 

RIKEN DNA Bank Human Resource - UBLCP1

Gene ID NCBI Gene 134510 |  KEGG hsa:134510
Gene Symbol UBLCP1
Protein Name ubiquitin like domain containing CTD phosphatase 1
Synonyms CPUB1
Ortholog resource in our bank

  UBLCP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005765 IRAK014G21 pCMV-SPORT6 BC013425 NM_145049 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170123 ARi25F03 pGCAP10 NM_145049.3  
GACTTCCGGTCGCTTTCGGTCTCTCAGCGGCCGGTTTCTGCGTCCGCTGCCGCAGGTTCC
HKR335256 RBb38C08 pGCAP1 NM_145049.3  
GCTCTCAGCGGCCGGTTTCTGCGTCCGCTGCCGCAGGTTCCACCGCGCTCCAGGTATTTT
HKR416267 RBdS040L03 pGCAP10 NM_145049.3  
GGCTTTCGGTCTCTCAGCGGCCGGTTTCTGCGTCCGCTGCCGCAGGTTCCACCGCGCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl