Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDCD2

Gene ID (NCBI) 134492
Gene Symbol NUDCD2
Protein Name NudC domain containing 2
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY094759 IRAL036O23 pDNR-LIB BC017934 NM_145266

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR276769 ARiS191P09 pGCAP10 NM_145266.4  
GGGCTCCGCCTGGTGCGGCCGCGGCCGGGAGGGACTGGATTATGTCGGCCCCGTTTGAGG
HKR277651 ARiS194C03 pGCAP10 NM_145266.4  
GGCGTGCGCTCGGCTCCGCCTGGTGCGGCCGCGGCCGGGAGGGACTGGATTATGTCGGCC
HKR391233 RBd78B09 pGCAP10 NM_145266.4  
GGCGGCCGGGAGGGACTGGATTATGTCGGCCCCGTTTGAGGAGCGGAGTGGGGTGGTACC
HKR432655 RBdS081K15 pGCAP10 NM_145266.4  
GAGGGANTGNATTATGTCGNCCCCGTTTGAGGAGCGGAGTGGGGTGGTACCGTGCGGGAC
HKR444028 RBdS110B04 pGCAP10 NM_145266.4  
GAGCCTAAGCGTGGGATTCCGCGCGTGCGCTCGGCTCCGCCTGGTGCGGCCGCGGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl