Prev. | 

RIKEN DNA Bank Human Resource - OCIAD2

Gene ID NCBI Gene 132299 |  KEGG hsa:132299
Gene Symbol OCIAD2
Protein Name OCIA domain containing 2
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027343 IRAK068F23 pCMV-SPORT6 BC032808 NM_152398 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094019 M01C035A19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094067 M01C035C19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094115 M01C035E19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094163 M01C035G19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094211 M01C035I19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094259 M01C035K19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094307 M01C035M19 pDONR221 MGC07-A10 BC032808 NM_152398  
HGE094355 M01C035O19 pDONR221 MGC07-A10 BC032808 NM_152398  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043349 ARe08G05 pKA1U5 NM_152398.2  
GGCAGTCACGGGGGAGCGAGGCCTGCTGGGCTTGGCAACGAGGGACTCGGCCTCGGAGGC
HKR044178 ARe10H10 pKA1U5 NM_152398.2  
ATCCTGGGACAGGTGGGGTACTCGGGAAGCTGGAGCGGGCCGGCGGTGCAGTCACGGGGG
HKR072103 ARe80E07 pKA1U5 NM_152398.2  
AGGTGGGGTACTCGGGAAGCTGGAGCGGGCCGGCGGTGCAGTCACGGGGGAGCGAGGCCT
HKR080453 ARf01C05 pKA1U5 NM_152398.2  
GGGGGAGACAGGTGGGGTACTCGGGAAGCTGGAGCGGGCCGGCGGTGCAGTCACGGGGGA
HKR185625 ARi64B01 pGCAP10 NM_152398.2  
HKR235058 ARiS087K18 pGCAP10 NM_152398.2  
GACAAAGGGCCGGAAGGAAGCCGGGGAGACAGGTGGGGTACTCGGGAAGCTGGAGCGGGC
HKR264661 ARiS161K21 pGCAP10 NM_152398.2  
GGGTGCAGTCACGGGGGAGCGAGGCCTGCTGGGCTTGGCAACGAGGGACTCGGCCTCGGA
HKR420470 RBdS051C22 pGCAP10 NM_152398.2  
GGGGAAGCTGGAGCGGGCCGGCGGTGCAGTCACGGGGGAGCGAGGCCTGCTGGGCTTGGC
HKR428371 RBdS070P11 pGCAP10 NM_152398.2  
GGAGACAGGTGGGGTACTCGGGAAGCTGGAGCGGGCCGGCGGTGCAGTCACGGGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl