Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT16

Gene ID (NCBI) 131870
Gene Symbol NUDT16
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 16
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005829 IRAK014J13 pCMV-SPORT6 BC009546 NM_152395 Full
HGY025204 IRAK063A04 pBluescriptR BC031215 NM_152395 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR178401 ARi46A01 pGCAP10 NM_152395.1
GAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGGGG
HKR384952 RBd62G08 pGCAP10 NM_152395.1
GAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGGGG
HKR389677 RBd74D05 pGCAP10 NM_152395.1
GGCAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.05

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl