Prev. |  KEGG KO K16855 > 

RIKEN DNA Bank Human Resource - NUDT16

Gene ID NCBI Gene 131870 |  KEGG hsa:131870
Gene Symbol NUDT16
Protein Name nudix hydrolase 16
Synonyms -
Ortholog resource in our bank

  NUDT16

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005829 IRAK014J13 pCMV-SPORT6 BC009546 NM_152395 Full
HGY025204 IRAK063A04 pBluescriptR BC031215 NM_152395 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178401 ARi46A01 pGCAP10 NM_152395.1  
GAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGGGG
HKR384952 RBd62G08 pGCAP10 NM_152395.1  
GAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGGGG
HKR389677 RBd74D05 pGCAP10 NM_152395.1  
GGCAGTGTCCGGCCATGGCCGGAGCCCGCAGGCTGGAGCTAGGCGAGGCCCTGGCGCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl