Prev. | 

RIKEN DNA Bank Human Resource - TMEM42

Gene ID NCBI Gene 131616 |  KEGG hsa:131616
Gene Symbol TMEM42
Protein Name transmembrane protein 42
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017111 IRAK042M23 pCMV-SPORT6 BC019851 NM_144638

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092822 M01C032A22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE092870 M01C032C22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE092918 M01C032E22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE092966 M01C032G22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE093014 M01C032I22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE093062 M01C032K22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE093110 M01C032M22 pDONR221 MGC05-F11 BC019851 NM_144638  
HGE093158 M01C032O22 pDONR221 MGC05-F11 BC019851 NM_144638  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175225 ARi38B01 pGCAP10 NM_144638.1  
GGGGCAGCGGGTGCCAGGCACGGTGTCAGCAGGCAACATGGCCGAGAGGCCGGGGCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl