Prev. | 

RIKEN DNA Bank Human Resource - DCBLD2

Gene ID NCBI Gene 131566 |  KEGG hsa:131566
Gene Symbol DCBLD2
Protein Name discoidin, CUB and LCCL domain containing 2
Synonyms CLCP1|ESDN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016851 IRAK042C03 pCMV-SPORT6 BC029658 NM_080927 Partial/var
HGY088734 IRAL021N22 pDNR-LIB BC007117 NM_080927 Partial/var
HGY092990 IRAL032H22 pDNR-LIB BC016815 NM_080927

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046100 ARe15E04 pKA1U5 NM_080927.3  
GGGAGCCGCGGGTGAGCGCGGCGAGCGGCGACCCTGGATGAGGAGCGCGGCGCGGGAGGC
HKR074948 ARe87G04 pKA1U5 NM_080927.3  
GGGGCCTGCCTGCCAGCTAGCCGGAGCCGCGGGNTTAGCGCGGCGAGCGGCGACCCTGGT
HKR176402 ARi41A02 pGCAP10 NM_080927.3  
GATGCCTCTGTTCCTCCTGCTCTTACTTGTCCTGCTCCTGCTGCTCGAGGACGCTGGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl