Prev. |  KEGG KO K09539 > 

RIKEN DNA Bank Human Resource - DNAJC19

Gene ID NCBI Gene 131118 |  KEGG hsa:131118
Gene Symbol DNAJC19
Protein Name DnaJ heat shock protein family (Hsp40) member C19
Synonyms PAM18|TIM14|TIMM14
Ortholog resource in our bank

  DNAJC19

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005732 IRAK014F12 pCMV-SPORT6 BC009702 NM_201261 Partial
HGX069688 IRAK174D16 pCMV-SPORT6 BC073989 NM_201261 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178426 ARi46B02 pGCAP10 NM_145261.2  
GGTAGGGCGCCTGTGCTTGAGGTTGGGGGTTGCGTCGCTCTCTGGTAAAGGCGTGCAGGT
HKR276781 ARiS191P21 pGCAP10 NM_145261.2  
GACTGCTTGAGCGACTTTCCTTCTCCTCCGCGTCCCCTTTTACGACAGTTTTCCGGCCTA
HKR277675 ARiS194D03 pGCAP10 NM_145261.2  
GGTGCTTGANGTTGGGGGTTGCTTCNCTCTCTGGNAAAGGCGTGCAGGTGTTGGCCGCGG
HKR405983 RBdS014P23 pGCAP10 NM_145261.2  
GAGGCGTGCAGGTGTTGGCCGCGGCCTCTGAGCTGGGATGAGCCGTGCTCCCGGTGGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl