Prev. | 

RIKEN DNA Bank Human Resource - AHSA2P

Gene ID NCBI Gene 130872 |  KEGG hsa:130872
Gene Symbol AHSA2P
Protein Name activator of HSP90 ATPase homolog 2, pseudogene
Synonyms AHA1|AHSA2|Hch1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039262 IRAK098C14 pCMV-SPORT6 BC050395 NM_152392 Partial/var
HGX056521 IRAK141F01 pCMV-SPORT6 BC063789 NM_152392 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384874 RBd62D02 pGCAP10 NM_152392.2  
GGGAAACGCTGGCTTCGGAGCCTTAGGCGCCGCGGCCTTTCCTTGTTTTCCGCCCAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl