Prev. | 

RIKEN DNA Bank Human Resource -

Gene ID NCBI Gene 129790 |  KEGG hsa:129790
Gene Symbol
Protein Name
Synonyms
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019385 IRAK048H17 pBluescriptR BC031037 NM_032625 Full
HGX039278 IRAK098D06 pCMV-SPORT6 BC050364 NM_032625 Full
HGY103018 IRAL057J02 pDNR-LIB BC070228 NM_032625 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184874 ARi62D02 pGCAP10 XR_040522.1  
GGCCCCGCGCACGGCGTCACCGTCTAGACGCAGGCTTGCAGCGGGCGGTGTCGTTCACGC
HKR402990 RBdS007H22 pGCAP10 XR_040522.1  
GGCAGGTGCGTTCCCGTCGAGGCTCGCGCAGCGGGCGTTTTTGGGGATCGCCTGGCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl