Prev. |  KEGG KO K18758 > 

RIKEN DNA Bank Human Resource - DIS3L2

Gene ID NCBI Gene 129563 |  KEGG hsa:129563
Gene Symbol DIS3L2
Protein Name DIS3 like 3'-5' exoribonuclease 2
Synonyms FAM6A|PRLMNS|hDIS3L2
Ortholog resource in our bank

  DIS3L2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013264 IRAK033C16 pBluescriptR BC026166 NM_152383 Full
HGY019498 IRAK048M10 pBluescriptR BC036113 NM_152383 Full
HGY028223 IRAK070J07 pBluescriptR BC030113 NM_152383 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181654 ARi54C06 pGCAP10 NM_152383.4  
GGCATTCTCCTTAGCAACTGCGGGACTGCGGCGGCGCCGGCCTCCGGGGAGAAACGCGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl