Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CHMP4B

Gene ID (NCBI) 128866
Gene Symbol CHMP4B
Protein Name charged multivesicular body protein 4B
Synonyms C20orf178|CHMP4A|CTPP3|CTRCT31|SNF7|SNF7-2|Shax1|VPS32B|Vps32-2|dJ553F4.4
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027422 IRAK068J06 pCMV-SPORT6 BC033859 NM_176812 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176501 ARi41E05 pGCAP10 NM_176812.3  
CGGCCGGCCGATGGGGGCGGAGGCGGAGGCGGAGGAGAGGCCTGCGGCGGCAGGGAGCGG
HKR363380 RBd08H12 pGCAP10 NM_176812.3  
GAGAGGCCTGCGGCGGCAGGGAGCGGCGGGACTGGGAGCGGGCGCGGGAGCCGACCCGAG
HKR365747 RBd14G03 pGCAP10 NM_176812.3  
GAGAGGCCTGCGGCGGCAGGNAGCGGCGGGACTGGGAGCGGGCGCCGGANCCGANNGAGC
HKR378808 RBd47A08 pGCAP10 NM_176812.3  
GGCGGGGCGGAGGCGGAGGCGGAGGAGAGGCCTGCGGCGGCAGGGAGCGGCGGGACTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl