Prev. |  KEGG KO K12194 > 

RIKEN DNA Bank Human Resource - CHMP4B

Gene ID NCBI Gene 128866 |  KEGG hsa:128866
Gene Symbol CHMP4B
Protein Name charged multivesicular body protein 4B
Synonyms C20orf178|CHMP4A|CTPP3|CTRCT31|SNF7|SNF7-2|Shax1|VPS32B|Vps32-2|dJ553F4.4
Featured content Endocytosis (human)
Ortholog resource in our bank

  CHMP4B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027422 IRAK068J06 pCMV-SPORT6 BC033859 NM_176812 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176501 ARi41E05 pGCAP10 NM_176812.3  
CGGCCGGCCGATGGGGGCGGAGGCGGAGGCGGAGGAGAGGCCTGCGGCGGCAGGGAGCGG
HKR363380 RBd08H12 pGCAP10 NM_176812.3  
GAGAGGCCTGCGGCGGCAGGGAGCGGCGGGACTGGGAGCGGGCGCGGGAGCCGACCCGAG
HKR365747 RBd14G03 pGCAP10 NM_176812.3  
GAGAGGCCTGCGGCGGCAGGNAGCGGCGGGACTGGGAGCGGGCGCCGGANCCGANNGAGC
HKR378808 RBd47A08 pGCAP10 NM_176812.3  
GGCGGGGCGGAGGCGGAGGCGGAGGAGAGGCCTGCGGCGGCAGGGAGCGGCGGGACTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl